PCR for HIF-1, PHD-2, VHL and internal standard GAPDH was performed using the following primers (forward 5GGCTTTGTTATGTGCTAAC3 and reverse 5ACTTGATGTTCATCGTCCTC3 for HIF-1), (forward 5TAAACGGCCGAACGAAAGC3 and reverse 5GGGTTATCAACGTGACGGACA3 for PHD-2), (forward 5ACAGGATGTGCAAGGACAAGTG3 and reverse 5TAGTCTGCAGCATTCCGTGAGT3 for VHL) and (forward 5ACCACAGTCCATGCCATCAC3 and reverse 5TCCACCACCCTGTTGCTGTA3 for GAPDH). PHD-2 inhibitor during OGD. Our findings showed that EPO treatment resulted in an increase in PHD-2 transcription and translation, inhibition of HIF-1 expression, reactive oxygen species (ROS) formation and matrix metalloproteinase (MMP)-9 activity, resulting in increased cell survival after OGD. We also observed that EPO-induced cell survival/neuroprotection was reversed by siRNA silencing of PHD-2. This led to the conclusion that PHD-2 is a key mediator of EPO-induced HIF-1 inhibition and subsequent neuroprotection in anin vitromodel of hypoxia ischemia. Keywords:HIF-1, PHD-2, EPO, OGD == Introduction == Stroke continues to be among the leading causes of mortality and morbidity; ischemic stroke accounts for approximately 75% of all incidents (ASA, AHA). Despite extensive stroke research, there are still very limited therapeutic options available. HIF-1 and HIF-2 are innate modulators of oxygen homeostasis in most aerobes (Zagorska & Dulak, 2004; Ratcliffe, 2007). However the specific HIF that is associated with EPO, neurons and neuroprotection is still a topic of frequent debate (Yeo et al., 2008). Cerebral ischemia promotes an accumulation of HIF-1 in neurons. During conditions of hypoxia, HIF-1 initiates the transcription of VEGF (Mu & Chang, 2003), EPO (Prass et al., 2003), glucose transporter (GLU-1), glycolytic enzymes (Jones & Bergeron, 2001a), and several prosurvival genes. However, H3 HIF-1 is also associated in promoting the transcription of proapoptotic genes such Asimadoline as, MMP-9 (DeNiro et al., 2010), Bcl2/adenovirus EIB 19kD-interacting protein 3 (Bruick, 2003), Nix (Sowers et al., 2001), p53 and the caspases (Li et al., 2005a). Under normoxic condition, HIF-1 is continuously synthesized and degraded in less than five minutes through the ubiquitinproteasome pathway (Huang et al., 1998;Kallio et al., 1999;Salceda & Caro, 1997). HIF-1 first undergoes hydroxylation by PHD-2, which allows it to interact with the von Hippel-Lindau (VHL) tumor suppressor gene (Ivan & Scaiano, 2003a;Jaakkola et al., 2001b;Lee et al., 2003). This interaction allows for the poly ubiquitination and proteasome-dependent degradation of HIF-1. PHDs are a family of three hydroxylase (PHD1-3) that are responsible for the hydroxylation of HIF in mammals. Recent studies have shown that PHD-2 activity is critical for HIF-1 degradation under normoxic conditions (Berra, 2003;Appelhoff, 2004). PHD-2 has a strikingly low O2affinity, which is ideal for oxygen sensing (Epstein et al., 2001d;Hirsila et al., 2003a). The absence of oxygen or reactive oxygen species (ROS) promotes the destabilization of PHD-2 (Cash et al., 2007a;Epstein et al., 2001c;Evans et al., 2005c;Jones & Bergeron, 2001c). HIF degradation pathways require either hydroxylation or acetylation, which is PHD-2 and oxygen dependent (Cash et al., 2007a;Epstein et al., 2001c;Evans et al., 2005c;Jones & Bergeron, 2001c). HIF-1 target gene, EPO, has been shown to modulate other target genes of HIF-1 such as matrix metalloproteinases Asimadoline (MMPs), vascular endothelial growth factor (VEGF), cyclooxygenase (COX), nitric oxide synthase (NOS) and p53 (Wang et al., 2008). Preclinical studies yielded promising results for the use of EPO in stroke therapy (Sun et al., 2005). However the effects of EPO on HIF-1 or its primary regulator PHD-2 have not been demonstrated. EPO was shown to stabilize Asimadoline mitochondrial membrane potential and decrease ROS in Abeta (2535)-induced neuronal toxicity in PC12 cells, which are up-regulated anti-apoptotic and down-regulated pro-apoptotic proteins (Li et al., 2005b). Although clinical trials using EPO in stroke therapy failed (Ehrenreich et al., 2009), it is still imperative to identify the key mediators of EPO-induced neuroprotection. This information will allow for a better prediction of the side effects and ultimately improve clinical translation. We hypothesized that EPO-treatment will increase PHD-2 Asimadoline during hypoxia, attenuating ROS and HIF-1 accumulation. We have explored this hypothesis using the OGD model with NGF differentiated PC-12 cells. The protein expression of HIF-1, HIF-2, PHD-2 and VHL, as well as ROS formation in the presence and absence of EPO treatment during OGD were assessed. We then investigated if pharmacological inhibition of EPO receptor.